홈>주문 및 견적요청>Sequencing

Sequencing

상단으로

주문하기

주문하기
주문일 2019-08-24 핸드폰번호
(주문현황 수신용)
주문자 / 실주문자 : 이메일
(분석결과 수신용)
기관/소속 포인트 사용
사용가능 포인트 : 0


추가기입

요청사항
요청사항


아래 내용을 반드시 확인하시고 주문해 주시기 바랍니다.

Sequencing Data Download 기간 : 3개월 (주문 및 결과조회 페이지에서 결과 Download 가능)
샘플 및 프라이머 보관 : 2주 (사전 협의 시 최대 3개월 보관 가능)
결과 발송 : 24시간 ~ 48시간 소요 (이메일 및 문자메세지 알림)


샘플정보 입력


개별 입력 주문
첨부파일 업로드 주문
입력란
No. 샘플 정보 프라이머 정보 Size (bp) 전기영동확인
(비정상적 band)
기타
(Vector name, 반응조건, 기타 요청사항)
삭제
샘플명 종류 농도
(ng/ul)
프라이머명 농도
(pmol/ul)
PCR product Plasmid insert

추가하기



Universal Primer List

Primer Name Primer Sequence Primer Name Primer Sequence
BGH-Rev TAGAAGGCACAGTCGAGG pJET1.2-For CGACTCACTATAGGGAGAGCGGC
pBlueScript KS TCGAGGTCGACGGTATC pJET1.2-Rev AAGAACATCGATTTTCCATGGCAG
pBlueScript SK CGCTCTAGAACTAGTGGATC pQE-For CCCGAAAAGTGCCACCTG
CMV-For CGCAAATGGGCGGTAGGCGTG pQE-Rev GTTCTGAGGTCATTACTGG
EBV-Rev GTGGTTTGTCCAAACTCATC RVp3 CTAGCAAAATAGGCTGTCCC
EGFP-CFor AGCACCCAGTCCGCCCTGAGC RVp4 GACGATAGTCATGCCCCGCG
EGFP-CRev CGTCCATGCCGAGAGTG SP6 ATTTAGGTGACACTATAG
EGFP-NRev CGTCGCCGTCCAGCTC SV40-pA-Rev CCTCTACAAATGTGGTATGG
GLP1 TGTATCTTATGGTACTGTAACTG SV40-Prom GCCCCTAACTCCGCCCATCC
GLP2 CTTTATGTTTTTGGCGTCTTCCA T3 ATTAACCCTCACTAAAG
M13-For(-20) GTAAAACGACGGCCAGT T7 AATACGACTCACTATAG
M13-For/pUC(-40) GTTTTCCCAGTCACGAC T7-EEV ATGTCGTAATAACCCCGCCCCG
M13-Rev(-20) GCGGATAACAATTTCACACAGG T7-Prom TAATACGACTCACTATAGGG
M13-Rev/pUC(-26) CAGGAAACAGCTATGAC T7-Ter GCTAGTTATTGCTCAGCGG
pBAD-For1 ATGCCATAGCATTTTTATCCA U-19mer GTTTTCCCAGTCACGACGT
pBAD-For2 ATGCCATAGCATTTTTATCC
pBAD-Rev GATTTAATCTGTATCAGG
pFastBac-For GGATTATTCATACCGTCCCA
pFastBac-Rev CAAATGTGGTATGGCTGATT
pGEX3' GGAGCTGCATGTGTCAGAGG
pGEX5' GGCAAGCCACGTTTGGTG

임시저장 주문하기

(주)디앤피바이오텍|사업자번호 : 504-81-66110|통신판매업번호 : 2011-대구중구-2582|대표 : 이명훈

Admin

Copyright (c) D&P BIOTECH Inc. All Rights Reserved.